Journal: Biomolecules

Article Title: TIPE2 Induced the Proliferation, Survival, and Migration of Lung Cancer Cells Through Modulation of Akt/mTOR/NF-κB Signaling Cascade

doi: 10.3390/biom9120836

Figure Lengend Snippet: Knockout of TIPE2 in lung cancer cells and its effect on different cancer hall marks. ( A ) Western blot analysis showing the expression of TIPE2 in NCIH460 lung cancer cells after CRISPR/Cas9 knockout (Left panel); Effect of TIPE2 knockout on the viability of NCIH460 lung cancer cells as analyzed by MTT assay (Right Panel); ( B ) Colony formation assay showing decreased clonogenic potential of lung cancer cells after knockout of TIPE2 (Left panel). Graphical representation of decreased clonogenic potential of TIPE2 knockout cells in terms of survival fraction (Right panel). ( C ) Cell migration was detected with the help of wound healing assay. Images were taken at 10× magnification at 0 and 24 h (Left panel). Graphical representation of the decreased migration potential of TIPE2 knockout cells compared to CRISPR/Cas9 scramble (right panel). ( D ) Effect of TIPE2 knockout on the progression of cell cycle in lung cancer cells analyzed through flow cytometry using PI/RNase solution (Left panel). Graphical representation of the effect of TIPE2 knockout on the cell cycle progression of lung cancer cells (Right panel). Data are represented as mean ± SE, * denotes p value < 0.05.

Article Snippet: NCIH460 human NSCLC cells were procured from National Centre for Cell Science (NCCS), Pune, India.

Techniques: Knock-Out, Western Blot, Expressing, CRISPR, MTT Assay, Colony Assay, Migration, Wound Healing Assay, Flow Cytometry

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) DOT1L mRNA expression levels in 1282 human cancer cell lines. DOT1L mRNA is highly expressed in SCLC cell lines ( n = 51) and NSCLC cell lines ( n = 135), indicated by red triangles. ( B ) Representative sections of NSCLC tumor tissues from two patients showing immunohistochemical detection of DOT1L protein (patient #1 has low DOT1L expression, and patient #2 has high DOT1L expression). Scale bars, 50 μm. The correlation between DOT1L protein expression level and overall survival is also shown. Log-rank (Mantel-Cox) test, ** P < 0.01. ( C ) Incidence of DOT1L mutations in 32 types of cancer, including lung adenocarcinoma (2.83%) and lung squamous cell carcinoma (1.64%). ( D ) Survival probability of lung cancer patients with DOT1L mutation ( n = 29) versus no DOT1L mutation ( n = 485). Log-rank (Mantel-Cox) test, ** P < 0.01. ( E ) Analysis of mutation frequency and mutation site of DOT1L in lung cancer cases from the cBioPortal database.

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: Expressing, Immunohistochemical staining, Mutagenesis

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) Protein expression levels of H3K79me2 in NCI-H460 cells transiently transfected with recombinant plasmids expressing different DOT1L mutants (E186A, Y216C, S225L, R231Q, I232N, N241T, F243L, A1003G, and A1003S) or WT DOT1L. Data are shown as means ± SEM. * P < 0.05, ** P < 0.01, and *** P < 0.001. P values were determined using one-way ANOVA with Tukey’s multiple comparisons test. ( B ) Heatmap showing the level of H3K79me2, cell growth, colony formation ability, and migration ability in NCI-H460 cells transiently transfected with recombinant plasmids expressing DOT1L mutants (E186A, Y216C, S225L, R231Q, I232N, N241T, F243L, A1003G, and A1003S) or WT DOT1L. Values are indicated as log 2 fold change. ( C ) Geometric and topological properties of DOT1L WT and R231Q protein structures determined by CASTp 3.0 software. The red shaded areas in the bottom panels are substrate binding pockets. ( D ) Levels of common histone H3 modifications (H3K79me1, H3K79me2, H3K79me3, H3K36me2, H3K27me3, H3K9me1, H3K9me2, and H3K4me1) in DOT1L WT cells or R231Q mutant cells (expressing DOT1L catalytic domain).

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: Expressing, Transfection, Recombinant, Migration, Software, Binding Assay, Mutagenesis

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) Western blotting analysis of tagged protein (DOT1L-flag) and H3K79me2 levels in NCI-H460-DOT1L-EV/WT/R231Q (expressing DOT1L catalytic domain). ( B ) DOT1L protein and H3K79me2 levels in NCI-H460-FULL-DOT1L-EV/WT/R231Q (expressing full-length DOT1L) or NCI-H460 DOT1L R231Q introduced by CRISPR. ( C ) RTCA assay of NCI-H460-DOT1L-EV/WT/R231Q for 90 hours. ( D ) Crystal violet staining, Transwell assay (scale bars, 200 μm), and tumorsphere formation assay (scale bars, 1000 μm) of NCI-H460-DOT1L-EV/WT/R231Q cells. ( E ) Crystal violet staining and tumorsphere formation assay of NCI-H460-FULL-DOT1L-EV/WT/R231Q or NCI-H460 parental/ DOT1L R231Q cells. Scale bars, 1000 μm. ( F ) CCK-8 assay data showing the sensitivity of NCI-H460-DOT1L-WT/R231Q cells to cisplatin, vinorelbine, and SGC0946. Cells were treated for 72 hours (cisplatin and vinorelbine) or 6 days (SGC0946). IC 50 values were calculated using SPSS V 21.0 software. ( G ) Tumor images and weights in the NCI-H460-DOT1L-WT/R231Q CDX model ( n = 7 mice per group). ( H ) Tumor images and volumes in the NCI-H460-FULL-DOT1L-EV/WT/R231Q or NCI-H460 parental/ DOT1L R231Q CDX model ( n = 6 mice per group). ( I ) CDX-bearing mice ( n = 7 mice per group) were treated with vehicle [10% dimethyl sulfoxide (DMSO) + 40% polyethylene glycol 300 (PEG300) + 5% Tween 80 + 45% saline, five times per week], cisplatin (3 mg/kg, twice per week), vinorelbine (4 mg/kg, twice per week), or SGC0946 (20 mg/kg, five times per week) through intraperitoneal administration. The graphs show the tumor images and weights, with the tumor inhibition rate (TIR%). (TIR%) = (1 − average tumor weight after drug treatment/average tumor weight of vehicle control) × 100%. Data are shown as means ± SEM. * P < 0.05, ** P < 0.01, and *** P < 0.001. In (A), (B), (D), and (E) to (H), P values were determined using Student’s t test (independent samples t test). Data from (I) were analyzed using one-way ANOVA with Tukey’s multiple comparisons test.

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: Western Blot, Expressing, CRISPR, Staining, Transwell Assay, Tube Formation Assay, CCK-8 Assay, Software, Saline, Inhibition, Control

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) DOT1L -depleted NSCLCs were infected with lentivirus encoding doxycycline (Dox)–inducible WT or mutant DOT1L (Tet-on system). ( B ) The cells generated in (A) were subjected to clonogenic survival assay by crystal violet staining 7 to 14 days after seeding. ( C ) The cells generated in (A) were seeded for tumorsphere formation assay and cultured for 7 to 14 days. Scale bars, 1000 μm. ( D ) Effect of doxycycline induction on the relative tumor volume in BALB/c-nu mice xenografted with NCI-H460-DOT1L-KD-DOT1L-WT/R231Q cells ( n = 10 mice per group). ( E ) Survival analysis of mice in the DOT1L WT and R231Q groups ( n = 20 mice per group and tumor volume > 2000 mm 3 ). ( F ) Western blotting analysis of DOT1L-flag and H3K79me2 expression in xenograft tumors from the CDX model in (D) ( n = 3). ( G ) Ki67 staining and TUNEL staining of the CDX tumors. Scale bars, 50 μm. Data are shown as means ± SEM. * P < 0.05, ** P < 0.01, and *** P < 0.001. In (A), P values were determined using one-way ANOVA with Tukey’s multiple comparisons test. Data from (B) to (D), (F), and (G) were analyzed using Student’s t test (independent samples t test). The log-rank (Mantel-Cox) test was used for (E), ** P < 0.01.

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: Infection, Mutagenesis, Generated, Clonogenic Cell Survival Assay, Staining, Tube Formation Assay, Cell Culture, Western Blot, Expressing, TUNEL Assay

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) Volcano plot showing the distribution of gene expression differences between H460 cells expressing R231Q or WT DOT1L. ( B ) GSEA analysis of the genes, which are up-regulated in H460-DOT1L-R231Q cells compared to H460-DOT1L-WT cells. GSEA identified the following gene sets: RAHALHO stemness, SCHAEFFER development, BENPORATH proliferation, gemcitabine resistance, WNT pathway, and STAT1 targets. ( C ) Bubble plot showing gene counts, P values, and enrichment scores of DOT1L R231Q cells versus WT cells. ( D ) Heatmap showing the effect of 12 different pathway inhibitors on DOT1L WT and R231Q cells. Cells were treated for 6 days. IC 50 values were generated using SPSS V 21.0 software. ( E ) RAF1, p-MEK, MEK, p-ERK, and ERK expression levels were detected in NCI-H460-DOT1L-WT/R231Q (expressing DOT1L catalytic domain), NCI-H460-FULL-DOT1L-WT/R231Q (expressing full-length DOT1L), or NCI-H460 parental/ DOT1L R231Q introduced by CRISPR. In addition, p-EGFR, EGFR, p-AKT, AKT, p-SMAD2/3, SMAD2/3, p-SRC, and SRC expression levels were detected in NCI-H460-R231Q and WT cell lines. ( F and G ) Effect of MEKi on cell proliferation and self-renewal in NCI-H460-DOT1L-WT/R231Q cells assayed by colony formation analysis (F) and tumorsphere formation analysis (G) 7 to 14 days after seeding. Scale bars, 1000 μm. ( H ) Synergistic effect of MAPK inhibition with cisplatin or vinorelbine on NCI-H460-DOT1L-R231Q cells after 72 hours of treatment. Combination index (CI) values were calculated using the CalcuSyn program. CI < 0.90 indicates synergism, 0.90 to 1.10 indicates an additive effect, and >1.10 indicates antagonism. Data are shown as means ± SEM. * P < 0.05, ** P < 0.01, and *** P < 0.001, as compared to the control group. ## P < 0.01, as compared to the WT group. Data from (F) and (G) were analyzed using Student’s t test (independent samples t test) and one-way ANOVA with Tukey’s multiple comparisons test.

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: Gene Expression, Expressing, Generated, Software, CRISPR, Inhibition, Control

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) ChIP-Seq assay results showing H3K79me2 signal intensities in cells expressing DOT1L WT and R231Q. ( B ) Venn diagram depicting the number of overlapping genes with H3K79me2 peaks in samples from cells expressing DOT1L WT or R231Q (top) and ChIP-Seq summary plot of H3K79me2 peak intensities in WT and R231Q cells (bottom). ( C ) ChIP-Seq tracks of H3K79me2 signals in the RAF1 , ELK3 , and KLF4 gene loci (top) and ChIP-qPCR assay for H3K79me2 modifications at the RAF1 locus (bottom). The green shaded areas are the H3K79me2 signals enriched in gene promoters. ( D ) Heatmap showing the relative mRNA expression levels of 29 predicted potential R231Q target genes in DOT1L WT and R231Q cells by qRT-PCR analysis (left). The expression levels of the top five up-regulated genes were then analyzed in DOT1L knockdown cells and R231Q cells incubated with DOT1Li SGC0946 (5 μM, 7 days). Histograms summarizing the qRT-PCR results are presented (right). ( E ) Western blotting analysis of RAF1, DOT1L-flag, and H3K79me2 expression in HepG2-DOT1L-WT/R231Q and RD-DOT1L-WT/R231Q cells. Data are shown as means ± SEM. * P < 0.05 and ** P < 0.01. Data from (C) were compared using Student’s t test (independent samples t test). In (D), P values were determined using one-way ANOVA with Tukey’s multiple comparisons test.

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: ChIP-sequencing, Expressing, ChIP-qPCR, Quantitative RT-PCR, Knockdown, Incubation, Western Blot

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) Scatterplot summarizing the efficacy of commercially available DOT1Lis and synthetic compounds (the gray dots) using the CCK-8 assay in H460 cells expressing DOT1L WT or R231Q. Cells were treated for 6 days. The values of IC 50 were calculated using SPSS V 21.0 software. ( B ) Binding of SGC0946 to the active site of WT and R231Q DOT1L in three-dimensional (3D) mode (top) and 2D mode (middle). The binding energy is shown at the bottom. ( C ) H3K79me2 levels in HCI-H460 cells expressing WT or R231Q DOT1L after treatment with different concentrations (0, 0.5, and 5 μM, 9 days) of DOT1Lis (SGC0946, EPZ004777, and EPZ5676). ( D ) Common gain-of-function DOT1L mutations in lung cancer (top) and the effects of DOT1Li SGC0946 (10 μM) or EPZ5676 (10 μM) on the colony-forming ability of cells transfected with the gain-of-function mutants Y216C, S225L, N241T, F243L, and A1003G (bottom). The number of colonies was assessed by crystal violet staining 7 to 14 days after seeding. Data are shown as means ± SEM. * P < 0.05, ** P < 0.01, and *** P < 0.001, as compared to the control group. # P < 0.05, as compared to the WT group. In (C), P values were determined using one-way ANOVA with Tukey’s multiple comparisons test and Student’s t test (independent samples t test).

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: CCK-8 Assay, Expressing, Software, Binding Assay, Transfection, Staining, Control

Journal: Science Advances

Article Title: Gain-of-function mutations in the catalytic domain of DOT1L promote lung cancer malignant phenotypes via the MAPK/ERK signaling pathway

doi: 10.1126/sciadv.adc9273

Figure Lengend Snippet: ( A ) Crystal violet staining of NCI-H460-DOT1L-WT/R231Q cells treated with SGC0946 (2.5 or 7.5 μM), binimetinib (2.5 or 7.5 μM), or the combination at the same concentrations for 7 to 14 days (top). Comparison of relative colony formation between groups at 7.5 μM drug concentration (bottom). ( B ) Clonogenic survival assay to evaluate the effects of DOT1Lis SGC0946 (1 μM), binimetinib (1 μM), or the combination at the same concentrations on cells transfected with constructs expressing the other DOT1L gain-of-function mutants (Y216C, S225L, N241T, F243L, and A1003G). The plates were photographed 7 to 14 days after seeding. ( C ) Tumor growth curves and images for four xenograft models ( n = 6 mice per group) that were treated with vehicle (10% DMSO + 40% PEG300 + 5% Tween 80 + 45% saline, five times per week), SGC0946 (10 mg/kg, five times per week), binimetinib (15 mg/kg, five times per week), or the combination at the same doses through intraperitoneal administration and oral gavage. The graphs show the TIR%. ( D ) IHC staining for Ki67 and TUNEL staining of the NCI-H1299-DOT1L-R231Q CDX tumor tissues. Scale bars, 50 μm. ( E ) Levels of RAF1, DOT1L-flag, p-MEK, MEK, and H3K79me2 in tumors from the NCI-H1299-DOT1L-R231Q CDX mice ( n = 2). ( F ) Summary diagram describing that regulation gain-of-function DOT1L mutations increase the malignant phenotypes of lung cancer by regulating the MAPK/ERK signaling pathway. Data are shown as means ± SEM. * P < 0.05, as compared to the WT group. # P < 0.05, ## P < 0.01, and ### P < 0.001, as compared to the single treatment group. In (A), P values were determined using one-way ANOVA with Tukey’s multiple comparisons test and Student’s t test (independent samples t test). In (C) and (D), P values were determined using one-way ANOVA with Tukey’s multiple comparisons test.

Article Snippet: NCI-H460 DOT1L R231Q cells introduced by CRISPR-Cas9 were obtained from Cyagen Biosciences (guide RNA, GCACTATGAGGGCTGCTCGA-GGG; donor oligo, AGGCCGGGGGTCCGCGCTCACACCTGTTTTCCCTTTCAGTTGGAGAGAGGCGATTTCCTC AGC GAAGAGTGGAGGGAG CAG ATCGCCAACACGAGGTATGGCCAGCGTGGGGCATGCAGGGCATGTGGGGTGTGCGCTCAC) and cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a humidified incubator with 5% CO 2 .

Techniques: Staining, Comparison, Concentration Assay, Clonogenic Cell Survival Assay, Transfection, Construct, Expressing, Saline, Immunohistochemistry, TUNEL Assay